Snippets- SNPit Song – So Long 2012 …Welcome 2013

– anu acharya

ACTACTCATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG

Past, Present and looking at the future,

Prediction is a sport serving as a society’s suture,

Mayans, Incans, Romans, Greeks,

Indus, Chinese and Aztecs were no fewer freaks,

Prophecies and vision of the future they had,

Regardless of the basis which may have been bad.

ACTTCTCATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG

And then today, we understand ourselves better,

The human genome: SNPs and other things that matter,

Excited at this new science, we saw a new company’s inception,

Mapmygenome.in started this year with a tremendous reception,

Its impact I know can be larger than life,

Insights to the self can make one come alive.

ACTACTCATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG

At Ocimum, we saw several interesting mutations,

Importantly though we moved our office locations,

More space, a garden, more interaction and recreation,

LIMS now saw the third avatar in its SaaS Enterprise edition,

Clean, Configurable and Classic in its looks,

New vibrant themes are in the books.

ACTAGTCATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG

Research accelerator emerged as a platform,

Genomics analysis are thereby undergoing a true reform,

ChipSeq, RNaseq and other analysis pipelines on this reside,

New algortihms are added to help from bench to bedside,

Algorithms for more than hundred diseases developed by the team,

An internal database MCART is probably a  bioinformatician’s dream.

ACTACTCATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG

Spoligos now making a dent in the diagnostics space,

Many new products for HCV, HPV, Dengue, Malaria are in the race,

New customers for sequencing, QRTPCR and others surfaced,

Value added services and bioinformatics re engaged,

Consulting on NGS, Literature mining and Software Development,

We continue to measure against customer satisfaction.

ACTACACATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG

We are thankful to our partners and customers around,

With your help, we have made a solid rebound,

Ocimum is an amalgamation of the best minds,

Ocimates are the most enthusiastic bunch that one can find,

Wishing you the best for 2013,

With all the success you have ever seen ,

ACTACTCATCATCACGACGACGCAGCAGCGCGATGCTGCGCTCGTCGTCGTCGTGGTCGTCGTCG

Happy Happy 2013.